View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10757_low_6 (Length: 253)

Name: NF10757_low_6
Description: NF10757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10757_low_6
NF10757_low_6
[»] chr1 (2 HSPs)
chr1 (91-253)||(17681590-17681752)
chr1 (17-60)||(17681427-17681470)


Alignment Details
Target: chr1 (Bit Score: 119; Significance: 7e-61; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 91 - 253
Target Start/End: Original strand, 17681590 - 17681752
Alignment:
91 ggggtaacgaatctgtgaagcaattactagcaggttcgatcgagctggtggacaaagtacgcggtttgactagactgagtaaagctatgtgtggctaaga 190  Q
    |||||||||||| |||||||||||||| |||| |||||||  |||||  |||||||||||||||||||| |||||||||||| |||||||||||||||||    
17681590 ggggtaacgaatatgtgaagcaattacaagcatgttcgattcagctgtcggacaaagtacgcggtttgattagactgagtaaggctatgtgtggctaaga 17681689  T
191 atgttttatccgttgaagcttaatccgatgataaaagaagaagtgttaggcagtaggagaatt 253  Q
    ||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
17681690 atgttttgtccgttgcagcttaatccgatgataaaagaagaagtgttaggcagtaggagaatt 17681752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 17 - 60
Target Start/End: Original strand, 17681427 - 17681470
Alignment:
17 agagtaagaaaaagacatgttttgtctgttgcgcagcttaaccc 60  Q
    |||||||||||||||||||||||||||| |||| ||||||||||    
17681427 agagtaagaaaaagacatgttttgtctgctgcgaagcttaaccc 17681470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University