View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10758_low_12 (Length: 240)
Name: NF10758_low_12
Description: NF10758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10758_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 17 - 232
Target Start/End: Original strand, 54698685 - 54698900
Alignment:
| Q |
17 |
taataatcgaatcatagcacctaagccctaaagaaaaacaacttacaagtgctgtttggattgctgaatggtaaacaggtatcaaactactttaattcgt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54698685 |
taataatcgaatcatagcacctaagccctaaagaaaaacaacttacaagtgctgtttggattgctgaatggtaaacaggtatcaaactactttaattcgt |
54698784 |
T |
 |
| Q |
117 |
gtgcaatttataaaaataactttctatggaggttgcaatgaggggcaatctcttttttcatgactagttgaacttgaaattctcttactccaactcatat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
54698785 |
gtgcaatttataaaaataactttctatggaggttgcaatgaggggcaatctcttttttcatgactagttgaacttgaaatactcttactccaactcatat |
54698884 |
T |
 |
| Q |
217 |
tgggatttttcatctc |
232 |
Q |
| |
|
| |||||||||||||| |
|
|
| T |
54698885 |
tcggatttttcatctc |
54698900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University