View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10758_low_16 (Length: 212)
Name: NF10758_low_16
Description: NF10758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10758_low_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 57; Significance: 5e-24; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 27 - 202
Target Start/End: Complemental strand, 22041605 - 22041410
Alignment:
| Q |
27 |
attgtaattattaggcacaagaggtatgaattcttgatgatttagcaacttgtatatat-------ttttattaattaaacagctaaaaatatgcatgca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| || |||||||||||| |||||||||||||||| |
|
|
| T |
22041605 |
attgtaattattaggcacaagaggtatgaattgttgatgatttagcaacttgtatatatacataaacatttttaattaaacagttaaaaatatgcatgca |
22041506 |
T |
|
| Q |
120 |
t---------------gcataacacaactctattttttgttgttgttggtaa-ttacctacaaccatgatggaagcaaaacacaaaatgaagaagatga |
202 |
Q |
| |
|
| || |||| |||||||||| ||||||||||||| ||||||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
22041505 |
tatcaaacatcaaacaccagtacacgactctatttt---ttgttgttggtaatttacctacaaccatgatggaaccaaaacacaaaattaagaagatga |
22041410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 26 - 85
Target Start/End: Original strand, 22017484 - 22017543
Alignment:
| Q |
26 |
gattgtaattattaggcacaagaggtatgaattcttgatgatttagcaacttgtatatat |
85 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
22017484 |
gattctaattattaggcacaagagatatgaattcttgatgatttagcaacttgtatatat |
22017543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University