View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10758_low_6 (Length: 299)
Name: NF10758_low_6
Description: NF10758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10758_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 40 - 286
Target Start/End: Complemental strand, 43483009 - 43482763
Alignment:
| Q |
40 |
aaatccatgcaactttcaataactaaaaccgggtgaaaatgtcacgtaccttctggcacaagataatgacatccacgattcatgtctgatgtattgccaa |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43483009 |
aaatccatgcaactttcaataactaaaaccgggtgaaaatgtcacgtaccttctggcacaagataatgacatccacgattcatgtctgatgtatttccaa |
43482910 |
T |
 |
| Q |
140 |
aactttgagnnnnnnntgtatcaaattttgagttgggccattggatatgtgccgcaatttgcagacaaggtaataccttcaagccctgcaacataggtgc |
239 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43482909 |
aactttgagaaaaaaatgtatcaaattttgagttgggccattggatatgtgccgcaatttgcagacaaggtaataccttcaagccctgcaacataggtgc |
43482810 |
T |
 |
| Q |
240 |
ggggccatatgtcaggtctgtaaccagtttaccctgccatcacttct |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43482809 |
ggggccatatgtcaggtctgtaaccagtttaccctgccatcacttct |
43482763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University