View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10758_low_8 (Length: 267)
Name: NF10758_low_8
Description: NF10758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10758_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 237; Significance: 1e-131; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 34439363 - 34439119
Alignment:
| Q |
1 |
cttttcatactatggttatgatttttgctgatagggaacctgattggaagtgtgttgaaggtatggagtgttcagccgatggaagtgtctgcgatatggc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
34439363 |
cttttcatactatggttatgatttttgctgatagggaacctgattggaagtgtgttgaaggtatggagtgttccgccgatggaagtgtctgcgatatggc |
34439264 |
T |
|
| Q |
101 |
gtcgtcgtcgtgggagtggatcggagggaaagatgcttctacggtgactgagtggagtttgatatgtggtgacaagtttaaagttggacttgttcaagct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34439263 |
gtcgtcgtcgtgggagtggatcggagggaaagatgcttctacggtgactgagtggagtttgatatgtggtgacaagtttaaagttggacttgttcaagct |
34439164 |
T |
|
| Q |
201 |
gttttctttactggttgtatgattggttcgttcattcttctctct |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34439163 |
gttttctttactggttgtatgattggttcgttcattcttttctct |
34439119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 34422505 - 34422272
Alignment:
| Q |
1 |
cttttcatactatggttatgatttttgctgatagggaacctgattggaagtgtgttgaaggtatggagtgttcagccgatggaagtgtctgcgatatggc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
34422505 |
cttttcatactatggttatgatttttgctgatagggaacctgattggaagtgtgttgaaggtatggagtgttccgccaatggaagtgtctgcgatatggc |
34422406 |
T |
|
| Q |
101 |
gtcgtcgtcgtgggagtggatcggagggaaagatgcttctacggtgactgagtggagtttgatatgtggtgacaagtttaaagttggacttgttcaagct |
200 |
Q |
| |
|
|||||||||||| ||||| | | || ||| ||||||||||||| |||| ||||||||||| |||||||| |||||||| ||||||||||||||||| |
|
|
| T |
34422405 |
atcgtcgtcgtggcagtgggttgctggtgaaggtgcttctacggtgtctgaatggagtttgatttgtggtgataagtttaagattggacttgttcaagct |
34422306 |
T |
|
| Q |
201 |
gttttctttactggttgtatgattggttcgttca |
234 |
Q |
| |
|
|||||||| |||| ||||||||||||| ||||| |
|
|
| T |
34422305 |
cttttctttgctgggtgtatgattggttagttca |
34422272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University