View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10759_high_1 (Length: 255)
Name: NF10759_high_1
Description: NF10759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10759_high_1 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 6 - 249
Target Start/End: Complemental strand, 34093680 - 34093456
Alignment:
| Q |
6 |
agaagcagagataaccagaaaaaggtaatgatattagcctgcacctcacttggatcttgagcttctaattatgcttgcctttcaagtcttcctgctctaa |
105 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34093680 |
agaatcagagataaccagaaaaaggtaatgatattagcctgcacctcacttggatcttgagcttctaattatgcttgcctttcaagtcttcctgctctaa |
34093581 |
T |
|
| Q |
106 |
ctgaacaaatccttgctagaaattaactagtgatgtgatgtgatgtgatgatgttaatgcaataaatggtagtaaaaatttgaaggatctttgataaaat |
205 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34093580 |
ctgaacaaatccttgc-------------------tgatgtgatgtgatgatgttaatgcaataaatggtagtaaaaatttgaaggatctttgataaaat |
34093500 |
T |
|
| Q |
206 |
tttcactctatgattttacatgtcgacatgatggtaatgctgct |
249 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
34093499 |
tttcactctatgattttacttgtcgacatgatggtaatgctgct |
34093456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University