View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10759_low_16 (Length: 289)
Name: NF10759_low_16
Description: NF10759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10759_low_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 11 - 272
Target Start/End: Original strand, 13015656 - 13015923
Alignment:
| Q |
11 |
cataggttgtatgaatgcataaagccataaacggattcacaagtagaagcacaaacgcataatatgcaagttgatgcacgagaggaaaaaacacaagctg |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
13015656 |
cataggttgtatgaatgcataaagccataaacggattcacaagtaaaagcacaaacgcataatatgcaagttgatgcacgagaggaaaaaacacaagttg |
13015755 |
T |
|
| Q |
111 |
aaatcccactgttataatgctaggatcaaggcgtc------nnnnnnnnnngaatcagcttgtataaaagccacgcaccagcagtgctaaaaggctagca |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13015756 |
aaatcccactgttataatgctaggatcaaggcgtcatttttttttttttttgaatcagcttatataaaagccacgcaccagcagtgctaaaaggctagca |
13015855 |
T |
|
| Q |
205 |
tcccatgcatactgaacaaaaccagcagcaagaaaggattaatgcagaaaagtacagcaaaaggaaag |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13015856 |
tcccatgcatactgaacaaaaccagcagcaagaaaggattaatgcagaaaagtacagcaaaaggaaag |
13015923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University