View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10759_low_23 (Length: 250)
Name: NF10759_low_23
Description: NF10759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10759_low_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 133 - 245
Target Start/End: Complemental strand, 40749726 - 40749614
Alignment:
| Q |
133 |
agaaacaaacaaaaaacaatcatttgaataaaattaacacattctagctagctcataattttccctttccctcttctgaaaaaatggggatgggaactag |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40749726 |
agaaacaaacaaaaaacaatcatttgaataaaataaacacattctagctagctcataattttccctttccctcttctgaaaaaatggggatgggaactag |
40749627 |
T |
 |
| Q |
233 |
cacctttgctact |
245 |
Q |
| |
|
|||||||| |||| |
|
|
| T |
40749626 |
cacctttgttact |
40749614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 88
Target Start/End: Complemental strand, 40749858 - 40749771
Alignment:
| Q |
1 |
ttctttggcttacaaagttacattaaacacaccgtgtgcgtcaccatcatcataaatattcattcatatcatataatcaaacagtaac |
88 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40749858 |
ttctttggcttacaaagttacattaaacacaccgtgtgcgtcaccatcatcataaatattcattcatatcataacatcaaacagtaac |
40749771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University