View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10759_low_27 (Length: 245)
Name: NF10759_low_27
Description: NF10759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10759_low_27 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 126 - 234
Target Start/End: Complemental strand, 45153015 - 45152907
Alignment:
| Q |
126 |
cttaaggtgtgacccattttacctatatctatatggatattgtggacagtggccttttcctacttaccgttcaccaaacaatccatttgatcaaacacca |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45153015 |
cttaaggtgtgacccattttacctatatctatatggatattgtggacagtggccttttcctacttaccgttcaccaaacaatccatttgatcaaacacca |
45152916 |
T |
|
| Q |
226 |
ccccccttt |
234 |
Q |
| |
|
||||||||| |
|
|
| T |
45152915 |
ccccccttt |
45152907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 18 - 53
Target Start/End: Complemental strand, 45153123 - 45153088
Alignment:
| Q |
18 |
aagtacaacactttctcataaccatcatagacacct |
53 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
45153123 |
aagtacaacactttctcataaccatcatagacacct |
45153088 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University