View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10759_low_35 (Length: 229)
Name: NF10759_low_35
Description: NF10759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10759_low_35 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 6 - 222
Target Start/End: Complemental strand, 37460195 - 37459979
Alignment:
| Q |
6 |
aaaatctactttcgtttgtttttatagaattagggttttcaattactttgttgaatgaattacggcgacgaacaatgttattgattgtgtttaggttact |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37460195 |
aaaatctactttcgtttgtttttatagaattagggttttcaattactttgttgaatgaattacggcgacgaacaatgttattgattgtgtttaggttact |
37460096 |
T |
|
| Q |
106 |
atcagattttaatgtgaatgactttggctacagtttgacttgagttggttatgtttcatttgattattatcgtaccaatttcgtttttgtaaaaatctgt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
37460095 |
atcagattttaatgtgaatgactttggctacaatttgacttgagttggttatgtttcatttgattattatcgtaccaatttcgtttttgtaataatctgt |
37459996 |
T |
|
| Q |
206 |
tctggaactgtgttaat |
222 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
37459995 |
tctggaactgtgttaat |
37459979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University