View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10759_low_39 (Length: 227)
Name: NF10759_low_39
Description: NF10759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10759_low_39 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 20 - 204
Target Start/End: Complemental strand, 33526700 - 33526516
Alignment:
| Q |
20 |
gtgctcactgttgaaacaaaattgtgtgtatgtcagtatgtccctggatcaaaccataaaaagaaccaagagttaaatctattctactctcttgtcattg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33526700 |
gtgctcactgttgaaacaaaattgtgtgtatgtcagtatgtccctggatcaaaccataaaaagaaccaagagttaaatctattctactctcttgtcattg |
33526601 |
T |
|
| Q |
120 |
aactctagaaccaaacatgccagtcaggaacagggaccatttcagaaatgtgtccacaagaattccaaaaacattctttagcttg |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33526600 |
aactctagaaccaaacatgccagtcaggaacagggaccatttcagaaatgtgtccacaagaattccaaaaacattctttagcttg |
33526516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University