View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10759_low_43 (Length: 205)
Name: NF10759_low_43
Description: NF10759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10759_low_43 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 188
Target Start/End: Complemental strand, 38339657 - 38339470
Alignment:
| Q |
1 |
ttctaataaggcagaacaagataccgctagagatgcctccagatttcatgccaggggaggtggttgaagacccgacacatggaacaaatgtatgcacttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38339657 |
ttctaataaggcagaacaagataccgctagagatgcctccaaatttcatgccaggggaggtggttgaagacccgacacatggaactaatgtatgcacttt |
38339558 |
T |
|
| Q |
101 |
ttgctagtttggttttannnnnnnnatgccactattcttttgatgcacatggtttatgataattttattataaatgtaatatttatca |
188 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38339557 |
ttgctagtttggttttattttttttatgccactatttttttgatgcacatggtttatgataattttattataaatgtaatatttatca |
38339470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 130 - 166
Target Start/End: Complemental strand, 38331654 - 38331618
Alignment:
| Q |
130 |
cactattcttttgatgcacatggtttatgataatttt |
166 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38331654 |
cactattcttttgatgcacatggtttatggtaatttt |
38331618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University