View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10760_high_8 (Length: 254)
Name: NF10760_high_8
Description: NF10760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10760_high_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 38033479 - 38033261
Alignment:
| Q |
1 |
atactaacaaagagggttctggaaagggtccatttctgagcacgacccacgatggaaaaaggaagccagtgtgtgggaatgaatgaatggagaatcgata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38033479 |
atactaacaaagagggttctggaaagggtccatttctgagcacgacccacgatggaaaaaggaagccagtgtgtaggaatgaatgaatggagaatcgata |
38033380 |
T |
|
| Q |
101 |
cggtggcgattcctccgattgtggacagatcttcggcggtgaaactattcattggtaagaaaaaattcagacttttttgggtagaatctgttaagggaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38033379 |
cggtggcgattcctccgattgtggacagatcttcggcggtgaaactattcattggtaagaaaaaattcagacttttttgggtagaatctgttaagggaaa |
38033280 |
T |
|
| Q |
201 |
gaccaattgtgaattctgg |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
38033279 |
gaccaattgtgaattctgg |
38033261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University