View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10760_low_19 (Length: 250)
Name: NF10760_low_19
Description: NF10760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10760_low_19 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 168 - 250
Target Start/End: Complemental strand, 40626975 - 40626893
Alignment:
| Q |
168 |
tttagtttggtagtttacatatttgtatttgggacaaaagttgtctcattgtagcaacaaaaatcttagtttttgtccgattt |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40626975 |
tttagtttggtagtttacatatttgtatttgggacaaaagttgtctcattgtagcaacaaaaatcttagtttttgtccaattt |
40626893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 14 - 85
Target Start/End: Complemental strand, 40627129 - 40627058
Alignment:
| Q |
14 |
agatcaagagagggagatagacacatattttggaaggagagagtaattggaagtagatgatccattttgaaa |
85 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40627129 |
agatcaagagagggagatagacacatattttggaaggagagagtaattggaagtagatgatccattttgaaa |
40627058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University