View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10760_low_26 (Length: 207)
Name: NF10760_low_26
Description: NF10760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10760_low_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 15 - 189
Target Start/End: Complemental strand, 46185641 - 46185465
Alignment:
| Q |
15 |
catagggatttggatgattatgactcaccaaaaatgaggaaagatcccaattttggtattaacatttgaattgctctattaattaatagcacagtaaaat |
114 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46185641 |
catagggatttagatgattatgactcaccaaaaatgaggaaagatcccaattttggtattaacatttgaattgctctattaattaatagcacagtaaaat |
46185542 |
T |
 |
| Q |
115 |
catattacaaa--ctctactagagtttttcttttaatttctcatttccttgcaattttaattaacataactaattat |
189 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46185541 |
catattacaaactctctactagagtttttcttttaatttctcatttccttgcaattttaattaacataactaattat |
46185465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University