View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10761_high_5 (Length: 237)
Name: NF10761_high_5
Description: NF10761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10761_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 5 - 224
Target Start/End: Complemental strand, 5691209 - 5690990
Alignment:
| Q |
5 |
gttcaaactcgctctaaatttttgataatataagctaaatattttatgttaggagccttaattaagaaatgcatttattgtaattgtgtttactgggatt |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5691209 |
gttcaaactcgctctaaatttttgataatataggctaaatattttatgttaggagccttaattaagaaatgcattcattgtaattgtgtttactgggatt |
5691110 |
T |
 |
| Q |
105 |
atagtactcctttgctgaagagataacatagaaaattgtaaaggcactgcaaaactaaaatctatgtttgtttagtaaaggctattcgattcagttggac |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5691109 |
atagtactcctttgctgaagagataacatagaaaattgtaaaggcactgcaaaactaaaatctatgtttgtttagtaaaggctattcgattcagttggac |
5691010 |
T |
 |
| Q |
205 |
tgggaagtatagaccctttt |
224 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
5691009 |
tgggaagtatagaccctttt |
5690990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University