View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10761_high_6 (Length: 217)
Name: NF10761_high_6
Description: NF10761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10761_high_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 66 - 202
Target Start/End: Complemental strand, 15054127 - 15053991
Alignment:
| Q |
66 |
cgttgctctaaatggaaaaatctgcaattttcaacgacaattatcttctttttccgccagatctaaactgtcgtccacaaatgtcctagggttttggcca |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
15054127 |
cgttgctctaaatggaaaaatctgcaattttcaacgacaattatcttctttttccgccagatctaaactgtcgtccacaaatgtactagggttttggcca |
15054028 |
T |
|
| Q |
166 |
agttctcttgtaagttgtttcttgaatctatttcaat |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15054027 |
agttctcttgtaagttgtttcttgaatctatttcaat |
15053991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University