View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10761_low_11 (Length: 357)
Name: NF10761_low_11
Description: NF10761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10761_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 127; Significance: 2e-65; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 157 - 342
Target Start/End: Complemental strand, 15972671 - 15972491
Alignment:
| Q |
157 |
gagtaactatatcagctacatgaaatccctgaactcaactttagacaaatcaaataaagctaccagaacggccccccatgggatctgaaaactcatacac |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15972671 |
gagtaactatatcagctacatgaaatccctgaactcaactttagacagatcaaataaagctaccagaacggccccccatgggatctgaaaactcatacac |
15972572 |
T |
|
| Q |
257 |
atgaaatgatgatacagnnnnnnnnnntagaatatatattaaatgtatgtataaatgctagctagcttgaaaccagtggataatta |
342 |
Q |
| |
|
||||||||||||||||| |||||||| |||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
15972571 |
atgaaatgatgatacag---aaaaaaatagaatatgtattaaatgtat-tat-aatgctagctagcttgaaaccagtggataatta |
15972491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 116; E-Value: 6e-59
Query Start/End: Original strand, 3 - 130
Target Start/End: Complemental strand, 15972825 - 15972698
Alignment:
| Q |
3 |
cagagagttgcacaaactccaaagaaatatatttacctaattgtatatataatgctaccatttacatgacagtttcaagcattgtcctttgcaattctca |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
15972825 |
cagagagttgcacaaactccaaagaaatatatttacctaattgtatatataatgctaccaattacatggcagtttcaagcattgtcctttgcaattctca |
15972726 |
T |
|
| Q |
103 |
tcactatctatctacagttgatatattt |
130 |
Q |
| |
|
|| ||||||||||||||||||||||||| |
|
|
| T |
15972725 |
tccctatctatctacagttgatatattt |
15972698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University