View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10761_low_12 (Length: 353)
Name: NF10761_low_12
Description: NF10761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10761_low_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 318; Significance: 1e-179; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 19 - 340
Target Start/End: Complemental strand, 41429449 - 41429128
Alignment:
| Q |
19 |
ggtgtgtatcaacacccagctttcagtggcaacggtctttatgaagtttgcaagcaatgttttatcatcttcatcagatcacagcacaatgaatgaaaac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41429449 |
ggtgtgtatcaacacccagctttcagtggcaacggtctttatgaagtttgcaagcaatgttttatcatcttcatcagatcacagcacaatgaatgaaaac |
41429350 |
T |
|
| Q |
119 |
attgtgacattcacaatgttacccctgacttttttcctttccaccaccatcttctccctcttcctcaaagacatgataaaccatatcaaccgccacacct |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
41429349 |
attgtgacattcacaatgttacccctgacttttttcctttccaccaccatcttctccctcttcctcaaagacatgataaaccatatcaaccaccacacct |
41429250 |
T |
|
| Q |
219 |
tacgtcttggcatgctactttgtgttgttggatctgtctttggctatttcttcttcatgactgctttataccattattggttcatccaagttggtcacaa |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41429249 |
tacgtcttggcatgctactttgtgttgttggatctgtctttggctatttcttcttcatgactgctttataccattattggttcatccaagttggtcacaa |
41429150 |
T |
|
| Q |
319 |
cttggaagctattacagttcct |
340 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
41429149 |
cttggaagctattacagttcct |
41429128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University