View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10761_low_21 (Length: 291)
Name: NF10761_low_21
Description: NF10761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10761_low_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 152; Significance: 2e-80; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 117 - 272
Target Start/End: Complemental strand, 33526082 - 33525927
Alignment:
| Q |
117 |
tataagagtaattaatattggaaaatgatcagattaattcatcttttccaacttcgactcctcgacattggatctgttaaaccaccaacaatccatgtct |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33526082 |
tataagagtaattaatattggaaaatgatcagattaattcatcttttccaacttcgactcctcgacattggatctgttaaaccaccaacaatccatgtct |
33525983 |
T |
|
| Q |
217 |
ctctagcaatgtcagttgaaataccataataatcagagtgatatctcatcactacc |
272 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33525982 |
ctctagcaatatcagttgaaataccataataatcagagtgatatctcatcactacc |
33525927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 54
Target Start/End: Complemental strand, 33526198 - 33526145
Alignment:
| Q |
1 |
atgatcataaaagattctaaacctggaaatttaatgttgaatttcccagttagc |
54 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
33526198 |
atgatcataaaagattctaaacctgggaatttaatgttgaatttcccagttagc |
33526145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University