View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10761_low_23 (Length: 272)
Name: NF10761_low_23
Description: NF10761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10761_low_23 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 17 - 259
Target Start/End: Original strand, 31883524 - 31883766
Alignment:
| Q |
17 |
caaaggtatatgtgccgaggatgtgtatcatgtcaatgaattttcctgtttttatgttctttgcaagaaatattttgctagtgcaatgtttcgctcgcaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31883524 |
caaaggtatatgtgccgaggatgtgtatcatgtcaatgaatttccttgtttttatgttctttgcaagaaatattttgctagtgcaatgtttcgctcgcaa |
31883623 |
T |
 |
| Q |
117 |
ggtgttgaagtgtgaactgtgtaagatgagactatgattatttgtcacatccctcatttaagatgtatttgatccttattacgaggaagagattgagtga |
216 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31883624 |
ggtgttgaagtgtgagctgtgtaagatgagactatgattatttgtcacatccctcatttaagatgtatttgatccttactacgaggaagagattgagtga |
31883723 |
T |
 |
| Q |
217 |
acatgacctttgatccccttccaccacgtgttagggctacttc |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31883724 |
acatgacctttgatccccttccaccacgtgttagggctacttc |
31883766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University