View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10761_low_24 (Length: 265)
Name: NF10761_low_24
Description: NF10761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10761_low_24 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 239; Significance: 1e-132; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 16 - 258
Target Start/End: Original strand, 38516248 - 38516490
Alignment:
| Q |
16 |
agttgaagaagcttatcttcctgaatacccatgctcttgctttcagggctacccttatgagtctgttgaatgatatagcacaaacactctggatccgttg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38516248 |
agttgaagaagcttatcttcctgaatacccatgctcttactttcagggctacccttatgagtctgttgaatgatatagcacaaacactctggatccgttg |
38516347 |
T |
|
| Q |
116 |
ccttgatactgttggcagcatcacagcattccttctttggtgtaggtgctttcccagttgcaaagtccagacatggaatcactttttgaaccactgatcc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38516348 |
ccttgatactgttggcagcatcacagcattccttctttggtgtaggtgctttcccagttgcaaagtccagacatggaatcactttttgaaccactgatcc |
38516447 |
T |
|
| Q |
216 |
acactttgaagccaaatcttcagctccattacagccacctatg |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38516448 |
acactttgaagccaaatcttcagctccattacagccacctatg |
38516490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 78 - 140
Target Start/End: Complemental strand, 52093253 - 52093187
Alignment:
| Q |
78 |
ctgttgaatgatatagcacaaacac----tctggatccgttgccttgatactgttggcagcatcaca |
140 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |||||| ||||||||||| |||||||| |
|
|
| T |
52093253 |
ctgttgaatgatatagcacaaacactctgtctggatccgctgcctttatactgttggctgcatcaca |
52093187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University