View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10761_low_27 (Length: 232)
Name: NF10761_low_27
Description: NF10761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10761_low_27 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 99; Significance: 5e-49; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 122 - 224
Target Start/End: Original strand, 45717708 - 45717810
Alignment:
| Q |
122 |
atgctaattaattcttgtgttataaatacaggtcgagttttggatatgtttgattctcaccattttgggttatcttcctggaattatctatgctatctct |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
45717708 |
atgctaattaattcttgtgttataaatacaggtcgagttttggatatgtttgattctcaccattttgggttatcttcctggaattatctatgctatctat |
45717807 |
T |
|
| Q |
222 |
gct |
224 |
Q |
| |
|
||| |
|
|
| T |
45717808 |
gct |
45717810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 45717587 - 45717648
Alignment:
| Q |
1 |
gccatcatccttccacctcttggtgtcttcctcaagtttggctgcaacgtaatatataaaac |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45717587 |
gccatcatccttccacctcttggtgtcttcctcaagtttggctgcaacgtaatatataaaac |
45717648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 139 - 219
Target Start/End: Original strand, 45705366 - 45705446
Alignment:
| Q |
139 |
tgttataaatacaggtcgagttttggatatgtttgattctcaccattttgggttatcttcctggaattatctatgctatct |
219 |
Q |
| |
|
||||||||||| |||| ||||| ||||| |||||| | |||||| |||| || |||||||||||||||||||||||||||| |
|
|
| T |
45705366 |
tgttataaatataggtggagttctggatctgtttggtgctcaccctttttggctatcttcctggaattatctatgctatct |
45705446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 45746050 - 45746094
Alignment:
| Q |
1 |
gccatcatccttccacctcttggtgtcttcctcaagtttggctgc |
45 |
Q |
| |
|
||||||||||| || ||||| |||||||||||||||||||||||| |
|
|
| T |
45746050 |
gccatcatcctccctcctctcggtgtcttcctcaagtttggctgc |
45746094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University