View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10761_low_30 (Length: 214)
Name: NF10761_low_30
Description: NF10761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10761_low_30 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 18 - 179
Target Start/End: Complemental strand, 6183038 - 6182880
Alignment:
| Q |
18 |
ggaacatctacccaattcagagttcctctcattcctctaccatcctttaccnnnnnnncttgtgtggttaaatagtttacaattaaattagtttaaacaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
6183038 |
ggaacatctacccaattcagagttcctctcattcctctaccatcctttacctttttttcttgtgaggttaaatagtttacaattaaattagtttaaacaa |
6182939 |
T |
|
| Q |
118 |
tttgttaacctacctatgacattctaaactacaatttcttaataatttagaatgtaatttgt |
179 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
6182938 |
tttgttcccctacctatgacattctaaactacaatttct---taatttagaatgtaatttgt |
6182880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University