View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10764_15 (Length: 322)
Name: NF10764_15
Description: NF10764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10764_15 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 47 - 316
Target Start/End: Original strand, 30508615 - 30508883
Alignment:
| Q |
47 |
attgaactctaattgcttgtcattgccaacgtgcactcatagttgtatggctatgtgatagtgattttgatctcagaatacannnnnnngaagaagcata |
146 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| | ||||||||||| |
|
|
| T |
30508615 |
attgaactctaattgcttgccattgccaacgtgcactcatagttgtatggctatgtgatagtgattttgatctcaggatatatttttttgaagaagcata |
30508714 |
T |
|
| Q |
147 |
tgcaggatatattgtcatccaaaattgagaataatccagatgattgtaatttgtaccaataagtgcttttggaagatgacagtgaggtgaatatgaacat |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
30508715 |
tgcaggatatattgtcatccaaaattgagaataatccagatgattgtaatttgtaccaataagtacttttggaagatgacagtgaggtgaatatgaacat |
30508814 |
T |
|
| Q |
247 |
gttcaaactgaaatgattttcttataatattgttgcttctgttgtgacaagtaaagtaacctttatacca |
316 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
30508815 |
gttcaaactgaaatgcttttcttataatattgttgcttcagttgtgacaagt-aagtaacctttatacca |
30508883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 31985104 - 31985144
Alignment:
| Q |
47 |
attgaactctaattgcttgtcattgccaacgtgcactcata |
87 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
31985104 |
attgaactctaattgcttgtcactgccaacgtacactcata |
31985144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University