View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10765_high_2 (Length: 405)
Name: NF10765_high_2
Description: NF10765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10765_high_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 57; Significance: 1e-23; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 15 - 87
Target Start/End: Original strand, 7501575 - 7501647
Alignment:
| Q |
15 |
ctctcttcatagctagcatacaacagtataccctaaaataatgaaataattaacatgagaaacaataattcaa |
87 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| |||||||| |||| |||||||||||||||||| |
|
|
| T |
7501575 |
ctctcttcatagctagcatacaacggtataccctaaaatactgaaataactaacttgagaaacaataattcaa |
7501647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 160 - 276
Target Start/End: Original strand, 7508659 - 7508775
Alignment:
| Q |
160 |
tagtttgcaaaattatttcaaattaagttgatattaactagcaacagattttgtagcaaaattatgataacaaatcaaacattttcttgaagtgaatata |
259 |
Q |
| |
|
||||||||| || |||||||||||||||||| |||||||| |||||||||||| || ||||||||||| ||||||| | ||| | ||| |||||| || |
|
|
| T |
7508659 |
tagtttgcagaactatttcaaattaagttgagtttaactagaaacagattttgtggccaaattatgatagcaaatcagatattattttgtagtgaacatg |
7508758 |
T |
 |
| Q |
260 |
attatgatggattcaac |
276 |
Q |
| |
|
||| ||||||||||||| |
|
|
| T |
7508759 |
attctgatggattcaac |
7508775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 336 - 401
Target Start/End: Original strand, 7501669 - 7501734
Alignment:
| Q |
336 |
atgtttgaagctaacctgttaaaagaaagtttcagcatacaaaaattatgttttccctatgctact |
401 |
Q |
| |
|
||||| |||||||||| |||||||||||||||||||||||||||| ||||||||| || ||||||| |
|
|
| T |
7501669 |
atgttagaagctaaccagttaaaagaaagtttcagcatacaaaaagtatgttttcactttgctact |
7501734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University