View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10765_high_5 (Length: 278)
Name: NF10765_high_5
Description: NF10765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10765_high_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 15 - 270
Target Start/End: Original strand, 42777913 - 42778168
Alignment:
| Q |
15 |
gacatcatctacataaatcgtcaacgttgtaaagatagtagaagtccttcttgtgaataaggaatgatgtgatttggattgaatgaaacaaattgagatt |
114 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42777913 |
gacatcatctacataaaccgtcaacgttgtaaagatagtagaagttcttcttatgaataaggaatgatgtgatttggattgaatgaaacaaattgagatt |
42778012 |
T |
|
| Q |
115 |
agaaaactagatggttaggagaaccattggtgacttgcttgttttaaaccataagagatttcagtaatctgcaaacttgactaggatttgaggaagtcac |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
42778013 |
agaaaactagatggttaggagaaccattggtgacttgcttgttttaaaccataagagatttcagtaatctgcaaacttgaataggatttgaggaagtcac |
42778112 |
T |
|
| Q |
215 |
accaagaggaagctttatataaacctcttcattattgttgtgtgtatccctttgct |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42778113 |
accaagaggaagctttatataaacctcttcattattgttgtgtgtatccctttgct |
42778168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University