View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10765_low_12 (Length: 292)
Name: NF10765_low_12
Description: NF10765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10765_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 237; Significance: 1e-131; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 25 - 277
Target Start/End: Complemental strand, 42777636 - 42777384
Alignment:
| Q |
25 |
tttagatattttatctgacaaacacattgctttggatccaacatttcatgagcgcaccaagcatattggcgttggttgtcacatagttcgtgagaagttg |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42777636 |
tttagatattttatctgacaaacacattgctttggatcctacatttcatgagcgcaccaagcatattggcgttggttgtcacatagttcgtgagaagtta |
42777537 |
T |
|
| Q |
125 |
cacacatttttgtccatcttcttactatcacctatatgaatctattgaccgactttttcatcaaggaacttgaatttgctcccttttagaggcttccttt |
224 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42777536 |
cacacatttttttccatcttcttactatcacctatatgaatctattgaccgactttttcatcaaggaacttgaatttgctcccttttagaggcttccttt |
42777437 |
T |
|
| Q |
225 |
caaactaggcatgtttaatgtacaagctccacgttgcggggagggagggtatt |
277 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
42777436 |
caaactaggcatgtttaatgtacatgctccacgttgcggggagggagggtatt |
42777384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 11 - 42
Target Start/End: Complemental strand, 42777768 - 42777737
Alignment:
| Q |
11 |
caaaggaaatatgatttagatattttatctga |
42 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
42777768 |
caaaggaaatatgatttagatattttatctga |
42777737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University