View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10765_low_21 (Length: 237)
Name: NF10765_low_21
Description: NF10765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10765_low_21 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 221; Significance: 1e-122; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 36903182 - 36902962
Alignment:
| Q |
1 |
gcgaagcaaagaggaagacattgaatgcaggattgccttctaatactggtctaccctcagttgttccgccaggtactgcacttgttgtggtgaaggaagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36903182 |
gcgaagcaaagaggaagacattgaatgcaggattgccttctaatactggtctaccctcagttgttccgccaggtactgcacttgttgtggtgaaggaagc |
36903083 |
T |
|
| Q |
101 |
accagcgacaagcgcggctacaaccgagcaggaatctgctgtgttttttagccattcattgctgtcttttataagaccttcatgtgattccttgaagata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36903082 |
accagcgacaagcgcggctacaaccgagcaggaatctgctgtgttttttagccattcattgctgtcttttataagaccttcatgtgattccttgaagata |
36902983 |
T |
|
| Q |
201 |
ttttcagctgttttgcctttg |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
36902982 |
ttttcagctgttttgcctttg |
36902962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 15 - 180
Target Start/End: Complemental strand, 36893366 - 36893198
Alignment:
| Q |
15 |
aagacattgaatgcaggattgccttctaatactggtctaccct---cagttgttccgccaggtactgcacttgttgtggtgaaggaagcaccagcgacaa |
111 |
Q |
| |
|
||||||| ||||||||| |||||||||||||| |||||||| | ||||||| ||||||||||| || |||| ||||| |||||| ||||||| |||| |
|
|
| T |
36893366 |
aagacatcgaatgcaggcttgccttctaataccggtctaccttgatcagttgtgccgccaggtacagcgcttgctgtggcaaaggaaacaccagctacaa |
36893267 |
T |
|
| Q |
112 |
gcgcggctacaaccgagcaggaatctgctgtgttttttagccattcattgctgtcttttataagacctt |
180 |
Q |
| |
|
| || | |||||| |||||||| || | ||||| |||||||||||| | ||||||||||||||||||| |
|
|
| T |
36893266 |
gggcagatacaacagagcaggattccgatgtgtcttttagccattcgctactgtcttttataagacctt |
36893198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University