View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10765_low_5 (Length: 405)

Name: NF10765_low_5
Description: NF10765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10765_low_5
NF10765_low_5
[»] chr8 (3 HSPs)
chr8 (15-87)||(7501575-7501647)
chr8 (160-276)||(7508659-7508775)
chr8 (336-401)||(7501669-7501734)


Alignment Details
Target: chr8 (Bit Score: 57; Significance: 1e-23; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 15 - 87
Target Start/End: Original strand, 7501575 - 7501647
Alignment:
15 ctctcttcatagctagcatacaacagtataccctaaaataatgaaataattaacatgagaaacaataattcaa 87  Q
    |||||||||||||||||||||||| ||||||||||||||| |||||||| |||| ||||||||||||||||||    
7501575 ctctcttcatagctagcatacaacggtataccctaaaatactgaaataactaacttgagaaacaataattcaa 7501647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 160 - 276
Target Start/End: Original strand, 7508659 - 7508775
Alignment:
160 tagtttgcaaaattatttcaaattaagttgatattaactagcaacagattttgtagcaaaattatgataacaaatcaaacattttcttgaagtgaatata 259  Q
    ||||||||| || ||||||||||||||||||  |||||||| |||||||||||| || ||||||||||| ||||||| | ||| | ||| |||||| ||     
7508659 tagtttgcagaactatttcaaattaagttgagtttaactagaaacagattttgtggccaaattatgatagcaaatcagatattattttgtagtgaacatg 7508758  T
260 attatgatggattcaac 276  Q
    ||| |||||||||||||    
7508759 attctgatggattcaac 7508775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 336 - 401
Target Start/End: Original strand, 7501669 - 7501734
Alignment:
336 atgtttgaagctaacctgttaaaagaaagtttcagcatacaaaaattatgttttccctatgctact 401  Q
    ||||| |||||||||| |||||||||||||||||||||||||||| ||||||||| || |||||||    
7501669 atgttagaagctaaccagttaaaagaaagtttcagcatacaaaaagtatgttttcactttgctact 7501734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University