View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10766_low_3 (Length: 240)
Name: NF10766_low_3
Description: NF10766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10766_low_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 18 - 128
Target Start/End: Complemental strand, 9499704 - 9499594
Alignment:
| Q |
18 |
cattttacatgcctgatgaaataacggtcacgcatcactccttggatgtgttgggcagcggctacatttagctacccaaaatcggtgcaaccaactaccg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||| |||| |||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
9499704 |
cattttacatgcctgatgaaataacggtcacgcaccactccttggatgcattggacagcggctacatttagctacccaaaatcagtgcaaccaactaccg |
9499605 |
T |
|
| Q |
118 |
tggcagagacc |
128 |
Q |
| |
|
||||||||||| |
|
|
| T |
9499604 |
tggcagagacc |
9499594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 162 - 237
Target Start/End: Complemental strand, 9499596 - 9499521
Alignment:
| Q |
162 |
accaaatacggtaaatctaaacacagctgtttcacttagaattatttgcagtctgttgggtctgaacagttccaac |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9499596 |
accaaatacggtaaatctaaacacagctgtttcacttagaattatttgcagtctgttgggtctgaacagttccaac |
9499521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University