View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10767_high_10 (Length: 217)
Name: NF10767_high_10
Description: NF10767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10767_high_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 6 - 203
Target Start/End: Complemental strand, 6341911 - 6341714
Alignment:
| Q |
6 |
gagtagcagagagcagtttccaataaagcaccaggtttttgagattatttgataatttagatgagaggtatgcaagttgaaatgatacggaacgtgtacc |
105 |
Q |
| |
|
|||||||| | |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6341911 |
gagtagcatatagcagtttccaataaagcacaaggtttttgagattatttgataatttagatgagaggtatgcaagttgaaatgatacggaacgtgtacc |
6341812 |
T |
 |
| Q |
106 |
ttgtacagtgggcgtcgagcatctttaagcgaatcatctttcaagcatgtacggttcaaggctctgtccagctctccctgccaattgaagttttcttt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6341811 |
ttgtacagtgggcgtcgagcatctttaagcgaatcatctttcaagcatgtacggttcaaggctctgtccagctctccctgccaattgaagttttcttt |
6341714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University