View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10767_high_7 (Length: 241)
Name: NF10767_high_7
Description: NF10767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10767_high_7 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 19 - 241
Target Start/End: Original strand, 43817663 - 43817885
Alignment:
| Q |
19 |
ttaccatcatgagggtattgataagtcccgcatgttagaccagcttcgtgtattgcaccgtcaaagcatgtcacatatgataacaacgaggatattacga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43817663 |
ttaccatcatgagggtattgataagtcccgcatgttagaccagcttcgtgtattgcaccgtcaaagcatgtcacatatgataacaacgaggatattacga |
43817762 |
T |
 |
| Q |
119 |
ttccacataaaatgtggaaatttttcatttcttctatgtatctatttcaatttcaattccctaatcgtcacgtttttaatgaaaacaaatcagattagga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43817763 |
ttccacataaaatgtggaaatttttcatttcttctatgtatctatttcaatttcaattccctaatcgtcacgtttttaatgaaaacaaatcagattagga |
43817862 |
T |
 |
| Q |
219 |
aatgtatgattggtgtttctttt |
241 |
Q |
| |
|
|||| |||||||||||||||||| |
|
|
| T |
43817863 |
aatgaatgattggtgtttctttt |
43817885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University