View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10767_high_9 (Length: 226)
Name: NF10767_high_9
Description: NF10767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10767_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 1 - 115
Target Start/End: Complemental strand, 2480849 - 2480735
Alignment:
| Q |
1 |
accaatcgatcatggtacaacgtaacaagttcagaggagttagacaacgacagtggggctcatgggtctcagaaattcgtcaccctttactgtaatctac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2480849 |
accaatcgatcatggtacaacgtaacaagttcagaggagttagacaacgacagtggggctcatgggtctcagaaattcgtcaccctttactgtaatctac |
2480750 |
T |
 |
| Q |
101 |
ttctccaacactata |
115 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
2480749 |
ttctccaacactata |
2480735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 27 - 88
Target Start/End: Original strand, 49532342 - 49532403
Alignment:
| Q |
27 |
aagttcagaggagttagacaacgacagtggggctcatgggtctcagaaattcgtcacccttt |
88 |
Q |
| |
|
|||||||||||||| || || || ||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
49532342 |
aagttcagaggagtcaggcagcgccagtggggctcttgggtgtcagaaattcgccacccttt |
49532403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University