View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10767_low_11 (Length: 351)
Name: NF10767_low_11
Description: NF10767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10767_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 18 - 238
Target Start/End: Complemental strand, 41965418 - 41965198
Alignment:
| Q |
18 |
agtaatggcaaccgtgtttcaccataaatcgcattagacatacatcaatgttgtgatttattttaatttgcttttatccttcaaaatcaaattctctata |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41965418 |
agtaatggcaaccgtgtttcaccataaatcgcattagacatacatcaatgttgtgatttattttaatttgcttttatccttcaaaatcaaattctctata |
41965319 |
T |
|
| Q |
118 |
tagacatagatggaccggaaggtatgaagctcacctttgggataatacttgtagaagggaaggtcaatcaagaaaaggacgtcaaggtaacaacaaatta |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
41965318 |
tagacatagatggaccggaaggtatgaagctcacctttgggataatacttgtagaagggaaggtcagtcaagaaaaggacgtcaaggtaacaacaaatta |
41965219 |
T |
|
| Q |
218 |
acttcaaaccacttaatgttt |
238 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
41965218 |
acttcaaaccacttaatgttt |
41965198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 305 - 346
Target Start/End: Complemental strand, 41965113 - 41965072
Alignment:
| Q |
305 |
actaacacatttccatttttcttcatcttgccctatgcttct |
346 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41965113 |
actaacacatttccatttttcttcatcttgccctatgcttct |
41965072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 60; Significance: 2e-25; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 116 - 207
Target Start/End: Complemental strand, 24563213 - 24563122
Alignment:
| Q |
116 |
tatagacatagatggaccggaaggtatgaagctcacctttgggataatacttgtagaagggaaggtcaatcaagaaaaggacgtcaaggtaa |
207 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||| | ||||||||||||||||| || |||||||| || |||||||| |
|
|
| T |
24563213 |
tatagacatagatggactggaaggtatgaagctcacctttgggataacagctgtagaagggaaggtcagtcgagaaaaggccgccaaggtaa |
24563122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 122 - 174
Target Start/End: Complemental strand, 30620032 - 30619980
Alignment:
| Q |
122 |
catagatggaccggaaggtatgaagctcacctttgggataatacttgtagaag |
174 |
Q |
| |
|
||||||||||| || || ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
30620032 |
catagatggacagggagatatgaagctcacctttgggataatagttgtagaag |
30619980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 118 - 167
Target Start/End: Complemental strand, 16869959 - 16869910
Alignment:
| Q |
118 |
tagacatagatggaccggaaggtatgaagctcacctttgggataatactt |
167 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| || |||||||| |||| |
|
|
| T |
16869959 |
tagacatagatggaccggaaggtttgaagctcatctatgggataagactt |
16869910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University