View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10767_low_14 (Length: 326)
Name: NF10767_low_14
Description: NF10767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10767_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 18 - 293
Target Start/End: Complemental strand, 49083718 - 49083443
Alignment:
| Q |
18 |
attaccaccactgaaactacaatttgcatgattgttctttggatatttatcaaaagtggccatcaagtcaatagctccagcagaatggtcttctagttca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49083718 |
attaccaccactgaaactacaatttgcatgattgttctttggatatttatcaaaagtggccatcaagtcaatagctccagcagaatggtcttctagttca |
49083619 |
T |
 |
| Q |
118 |
ttattgctttgatgaatctttgtattaatatgaggatgggctttgcttaactctgttcctaacacttcatcacggttttctgtttcactgtaatcatagt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
49083618 |
ttattgctttgatgaatctttgtattaatatgaggatgggctttgcttaactctgttcctaacacttcatcacggttttctgtttcactataatcatagt |
49083519 |
T |
 |
| Q |
218 |
tttgaccaagccttaaacctgttgaaattttgtcacaccctgcagctttagatgctattgtagttgatttctctgc |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49083518 |
tttgaccaagccttaaacctgttgaaattttgtcacaccctgcagctttagatgctattgtagttgatttctctgc |
49083443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University