View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10767_low_19 (Length: 250)
Name: NF10767_low_19
Description: NF10767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10767_low_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 6 - 240
Target Start/End: Complemental strand, 2018472 - 2018238
Alignment:
| Q |
6 |
agaagcagagaccaactcggtacaagcaacaatagtaaaacaatactcaatattttatgatacaatataatattttgcacacattagaatcgtccggatc |
105 |
Q |
| |
|
||||||| | ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2018472 |
agaagcacaaaccaactcggtacaagcaacaatagtacaacaatactcaatattttatgatacaatataatattttgcacacattagaatcgtccggatc |
2018373 |
T |
 |
| Q |
106 |
catccgattagtcttaaaggtgaaaacaaatatcgagtattattgtgcttgctttaagcaacatgacaagcaaagagaaagaagcgggattagtaatcca |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||| |||||| |
|
|
| T |
2018372 |
catccgattagtcttaaaggtgaaaacaaatatcgagtattattgtgcttgctttaagcaacatgacaagcaaagagaaagaagcaggactaggaatcca |
2018273 |
T |
 |
| Q |
206 |
ttcaatttgtcccacttccgcctctttgcttgttc |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
2018272 |
ttcaatttgtcccacttccgcctctttgcttgttc |
2018238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000006; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 48 - 84
Target Start/End: Complemental strand, 11355561 - 11355525
Alignment:
| Q |
48 |
atactcaatattttatgatacaatataatattttgca |
84 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11355561 |
atactcaatattttatgatacaatataatattttgca |
11355525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 48 - 84
Target Start/End: Original strand, 11371833 - 11371869
Alignment:
| Q |
48 |
atactcaatattttatgatacaatataatattttgca |
84 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11371833 |
atactcaatattttatgatacaatataatattttgca |
11371869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University