View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10767_low_21 (Length: 241)
Name: NF10767_low_21
Description: NF10767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10767_low_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 1307239 - 1307015
Alignment:
| Q |
1 |
caccaattgcaagccgtttcggatctcttccacctgtttcatcaaaatctcat--caattaactaccaaaacacacacaaaattaacatataattacacg |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1307239 |
caccaattgcaagccgtttcggatctcttccacctgtttcatcaaaatctcatatcaattaactaccaaaacacacacaaaattaacatataattacaca |
1307140 |
T |
|
| Q |
99 |
attaaataaataaaactgaaaattcgtgttaccttcagtgattaagcaaattgacttgcgcttacgggattgaaacgaagttgaattttggaactgaaat |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1307139 |
attaaataaataaaactgaaaattcgtgttaccttcagtgattgagcaaattgacttgcgcttacgggattgaaacgaagttgaattttggaactgaaat |
1307040 |
T |
|
| Q |
199 |
gagaaaaacctagccagggccaaag |
223 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
1307039 |
gagaaaaacctagccagggccaaag |
1307015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University