View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10767_low_22 (Length: 240)

Name: NF10767_low_22
Description: NF10767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10767_low_22
NF10767_low_22
[»] chr2 (1 HSPs)
chr2 (1-240)||(38831345-38831584)
[»] chr4 (1 HSPs)
chr4 (41-92)||(30463872-30463923)


Alignment Details
Target: chr2 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 38831584 - 38831345
Alignment:
1 agccaaagagaaatggaggagaatttatcaattgagacatgtgactttgctgatctttccgaaggaaacttattggaaagcatcaatttcgaattcgatg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
38831584 agccaaagagaaatggaggagaatttatcaattgagacatgtgactttgctgatctttccgaagggaacttattggaaagcatcaatttcgaattcgatg 38831485  T
101 atgatttcttcgtatgtttcaacgacggagatgtgttaccggatcttgagatggacccggaaatgcttgctgaattctccctcagcagcagcggtgagga 200  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38831484 atgatttcttcgtatgcttcaacgacggagatgtgttaccggatcttgagatggacccggaaatgcttgctgaattctccctcagcagcagcggtgagga 38831385  T
201 atcggatataaattcgtcgggtgcaaatagcaaatcttgt 240  Q
    ||||||||||||||||||||||||||||||||||||||||    
38831384 atcggatataaattcgtcgggtgcaaatagcaaatcttgt 38831345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 41 - 92
Target Start/End: Original strand, 30463872 - 30463923
Alignment:
41 gtgactttgctgatctttccgaaggaaacttattggaaagcatcaatttcga 92  Q
    |||||||||  || |||||||||||||| ||||||||||||||||| |||||    
30463872 gtgactttggcgacctttccgaaggaaatttattggaaagcatcaacttcga 30463923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University