View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10767_low_23 (Length: 240)

Name: NF10767_low_23
Description: NF10767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10767_low_23
NF10767_low_23
[»] chr6 (2 HSPs)
chr6 (120-240)||(3310010-3310130)
chr6 (11-49)||(3310201-3310239)


Alignment Details
Target: chr6 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 120 - 240
Target Start/End: Complemental strand, 3310130 - 3310010
Alignment:
120 agatcattttaaaactttgtcttgctagaacacacgttatacaacttgattattctgagactaatatctatgacaaataaatactcaatacgaatcaata 219  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||    
3310130 agatcattttaaaattttgtcttgctagaacacacgttatacaacttgactattctgagactaacatctatgacaaataaatactcaatacgaatcaata 3310031  T
220 aactaacgatcatacaaactt 240  Q
    ||| |||||||||||||||||    
3310030 aaccaacgatcatacaaactt 3310010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 11 - 49
Target Start/End: Complemental strand, 3310239 - 3310201
Alignment:
11 atcatcaagtgtttaggaggaaaagctgtgacaacttga 49  Q
    |||||| ||||||||||||||||||||||||||||||||    
3310239 atcatctagtgtttaggaggaaaagctgtgacaacttga 3310201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University