View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10767_low_23 (Length: 240)
Name: NF10767_low_23
Description: NF10767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10767_low_23 |
 |  |
|
| [»] chr6 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 120 - 240
Target Start/End: Complemental strand, 3310130 - 3310010
Alignment:
| Q |
120 |
agatcattttaaaactttgtcttgctagaacacacgttatacaacttgattattctgagactaatatctatgacaaataaatactcaatacgaatcaata |
219 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3310130 |
agatcattttaaaattttgtcttgctagaacacacgttatacaacttgactattctgagactaacatctatgacaaataaatactcaatacgaatcaata |
3310031 |
T |
 |
| Q |
220 |
aactaacgatcatacaaactt |
240 |
Q |
| |
|
||| ||||||||||||||||| |
|
|
| T |
3310030 |
aaccaacgatcatacaaactt |
3310010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 11 - 49
Target Start/End: Complemental strand, 3310239 - 3310201
Alignment:
| Q |
11 |
atcatcaagtgtttaggaggaaaagctgtgacaacttga |
49 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3310239 |
atcatctagtgtttaggaggaaaagctgtgacaacttga |
3310201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University