View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10767_low_25 (Length: 237)
Name: NF10767_low_25
Description: NF10767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10767_low_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 15 - 220
Target Start/End: Original strand, 35210316 - 35210522
Alignment:
| Q |
15 |
atgaatgaaggggatgtgtatatgtattttctctcgaacgtccatgatagtcatcgttaacaaaagtccaactagtgatttatggttggcaagaggctat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35210316 |
atgaatgaaggggatgtgtatatgtattttctctcgaacgtccatgatagtcattgttaacaaaagtccaactagtgatttatggttggcaagaggctat |
35210415 |
T |
 |
| Q |
115 |
gaagggttgataaatgaattttgttaaattcatagaaggtttatttgttaaggtggtctggtgcatagaaagatcaacta-gttcagttgagacatgatg |
213 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35210416 |
gaaggggtgataaatgaattttgttaaattcatagaaggtttatttgttaaggtggtctggtgcatagaaagatcaactaggttcagttgagacatgatg |
35210515 |
T |
 |
| Q |
214 |
catcttt |
220 |
Q |
| |
|
||||||| |
|
|
| T |
35210516 |
catcttt |
35210522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University