View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10767_low_28 (Length: 229)
Name: NF10767_low_28
Description: NF10767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10767_low_28 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 30 - 183
Target Start/End: Original strand, 22761548 - 22761701
Alignment:
| Q |
30 |
gtggttgatacacaagatatgtaaaataagtatcaccacacgtaactatagtgattaattttgagt-ggaataagagccacatagtcatgaaaatgctac |
128 |
Q |
| |
|
||||||||| || ||||| ||| |||||||||||| ||||||||||||||||||||| || ||| ||| |||||| |||||||||||||||||||||| |
|
|
| T |
22761548 |
gtggttgatgcataagatgtgtgaaataagtatcatg-cacgtaactatagtgattaatcttaagtcggagtaagagtcacatagtcatgaaaatgctac |
22761646 |
T |
|
| Q |
129 |
tagaagaattttaacggtgttaatttttctgtttgtaaatttgaatatggactag |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22761647 |
tagaagaattttaacggtgttaatttttctgtttgtaaatttgaatatggactag |
22761701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University