View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10769_14 (Length: 302)
Name: NF10769_14
Description: NF10769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10769_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 250 - 290
Target Start/End: Complemental strand, 45153015 - 45152975
Alignment:
| Q |
250 |
cttaaggtgtgacccattttacctatatctatatggatatt |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45153015 |
cttaaggtgtgacccattttacctatatctatatggatatt |
45152975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University