View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1076_low_7 (Length: 321)
Name: NF1076_low_7
Description: NF1076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1076_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 7e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 7e-86
Query Start/End: Original strand, 87 - 251
Target Start/End: Original strand, 29719605 - 29719769
Alignment:
| Q |
87 |
aagtctaccccatagattggggatgtatcttgactctcaaaagctttaacaagatcaagttcaaaatgatgaagatctatggccaattgaaaatatgctt |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29719605 |
aagtctaccccatagattggggatgtatcttgactctcaaaagctttaacaagatcaagttcaaaatgatgaagatctatggccaattgaaaatatgctt |
29719704 |
T |
 |
| Q |
187 |
tcctggttgaaagtttcatagaagcagctaccatgtgcatcccattgaccttcccaaaagttcat |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
29719705 |
tcctggttgaaagtttcatagaagcagctaccatgtgcatcccattggccttcccaaaagttcat |
29719769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University