View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10770_high_1 (Length: 239)
Name: NF10770_high_1
Description: NF10770
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10770_high_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 1045609 - 1045813
Alignment:
| Q |
1 |
gatcttttcttcactgtttgaatctattcgattaacaattataataaataactcatcgtaatcacgttttgtgctcctaattttttcaatttatcttgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
1045609 |
gatcttttcttcactgtttgaatctattcgattaacaagtataataaataactcat-------------tgtgctcctaattttttcaatttatcttgtt |
1045695 |
T |
|
| Q |
101 |
atttgttatttttggcaaacattctgtgtgtgtgactgaaatttttgttaaaatttaaagaaaatggaaaagtagtttgtttaaggagttgatatgactt |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1045696 |
atctgttatttttggcaaacattctgtg--tgtgactgaaatttttgttaaaatttaaagaaaatggaaaagtagtttgtttaaggagttgatatgactt |
1045793 |
T |
|
| Q |
201 |
gaattgtggctataacttat |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
1045794 |
gaattgtggctataacttat |
1045813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University