View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10770_high_3 (Length: 217)
Name: NF10770_high_3
Description: NF10770
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10770_high_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 26620603 - 26620821
Alignment:
| Q |
1 |
ctagaaagaggggattgttcactgattcccgttggctcaaatgattttgagccttaa------cggtttttgattacgcatttctctgacgtaaccgttt |
94 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26620603 |
ctagaaagaggggattgttcactggttcccgttggctcaaatgattctgagccttaacgttaacggtttttgattacgcatttctctgacgtaaccgttt |
26620702 |
T |
|
| Q |
95 |
tcggttacaagttactctaccacaacggtttacatttagtctctgcacaggaaattatgaccggaaatcgcaagagaaacaccgaagtaaatcctccact |
194 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |||||||||||||| ||||| ||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
26620703 |
tcggttacaagttactctaccacaacgatttacagttagtctctgcacaagaaatcatgactggaattcgcaagagaaacaccgaagtaaatcctccact |
26620802 |
T |
|
| Q |
195 |
gcagcggaggttcgatctg |
213 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
26620803 |
gcagcggaggttcgatctg |
26620821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University