View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10771_5 (Length: 408)
Name: NF10771_5
Description: NF10771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10771_5 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 85 - 408
Target Start/End: Original strand, 52556663 - 52556979
Alignment:
| Q |
85 |
tgagatttttacttttctgtgtgtttcatggatttgtgatgtggcagaagagagcaatcttttgtattgggtatagagcatatctcagtggtttgctttc |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
52556663 |
tgagatttttacttttctgtgtgtttcatggatttgtgatgcggcagaagagagcaatcttttgtattgggtatagagcatatctcagtggttttctttc |
52556762 |
T |
|
| Q |
185 |
atctgggttagtgtaaacaatctagtaccttggatacaaacaaattcaagatgagaggaggctctttatgtttaccttgtaattgttgtgtcattgacgt |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52556763 |
atctgggttagtgtaaacaatctagtaccttggat----acaaattcaagatgagaggaggctctttatgtttaccttgtaattgttgtgtcattgacgt |
52556858 |
T |
|
| Q |
285 |
actagaagtgctttttaactatctgagtattattgcgagtttcgcgttgacttttatatgacctgttgttttgttgagttgagttaagtctaaccaaatt |
384 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
52556859 |
actagaagtgctttttaactatctgagtattattgcgagtttcgtgttgacttttatatgacc---tgttttgttgagttgagttaagtctaaccaaatt |
52556955 |
T |
|
| Q |
385 |
ttaagaagtagcagtactatgaca |
408 |
Q |
| |
|
||||||||||| |||||||||||| |
|
|
| T |
52556956 |
ttaagaagtagtagtactatgaca |
52556979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University