View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10771_7 (Length: 334)
Name: NF10771_7
Description: NF10771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10771_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 53 - 329
Target Start/End: Complemental strand, 29007265 - 29006989
Alignment:
| Q |
53 |
gttcacctttcagctatcaactagctagctcacactagacagtttatttcactgatgtgggtgtttggtcatttataatgacatattgtttagtacatat |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
29007265 |
gttcacctttcagctatcaactagctagctcacactagacagtttatttcactgatgtgggtgtttggtcattcataatgacatattgtttagtacatat |
29007166 |
T |
 |
| Q |
153 |
agattgtgatttggtttagtgactttagtcaattgttccaaagtgagtgatgttcttgtgttgctaatgtgagaatctttgctactgtgaatttgtttgt |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29007165 |
agattgtgatttggtttagtgactttagtcaattgttccaaagtgagtgatgatcttgtgttgctaatgtgagaatctttgctactgtgaatttgtttgt |
29007066 |
T |
 |
| Q |
253 |
tagcaaatgaacttgtttagttcaaagtaaactctgtatactcaatttgagaatttgattgtagactctctgctcct |
329 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
29007065 |
tagcaaatgaacttgtttagttcaaagtaaactctgtatactcaatttgagaatttgattgtagactctttgctcct |
29006989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University