View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10771_low_14 (Length: 205)
Name: NF10771_low_14
Description: NF10771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10771_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 21 - 181
Target Start/End: Complemental strand, 35392801 - 35392641
Alignment:
| Q |
21 |
atcaaaaccgccatccactctaaccccgctcgccgtaccgccttcgagtccatcggcatcaccgtcctttcttcaaacgacgacgtattattcattccct |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35392801 |
atcaaaaccgccatccactctaaccccgctcgccgtaccgccttcgagtccatcggcatcaccgtcctttcttcaaacgacgacgtattattcattccct |
35392702 |
T |
 |
| Q |
121 |
ctcaattgtttcactatttattacaactgcgttgcgttttcctattatcattttctcattc |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
35392701 |
ctcaattgtttcactatttattacaactgcgttgcgttttccttttatcattttctcattc |
35392641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University