View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10773_high_1 (Length: 257)
Name: NF10773_high_1
Description: NF10773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10773_high_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 8 - 242
Target Start/End: Complemental strand, 52709053 - 52708819
Alignment:
| Q |
8 |
tagcagagcagttctatcctgaacaaaagatgtgccgttttcataaaagtttcacaaacatnnnnnnnnnnnnnnnnnncgcggatgggcatcagcaata |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
52709053 |
tagcagagcagttctatcctgaacaaaagatgtgccattttcataaaagtttcacaaacattgtgttgtgttgtgagtgcgcggatgggcatcagcaata |
52708954 |
T |
 |
| Q |
108 |
aggtgtgggatattgcggtgttactgcgacatgttatgtcactgatggtgaattcgagaaataggccaagttcacttgattcaactcatgcctaggcatg |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
52708953 |
aggtgtgggatattgcggtgttactgcgacatgttatgtcactgatggtgaattcgagaaataggccaagttcccttgattccactcatgcctaggcatg |
52708854 |
T |
 |
| Q |
208 |
tagttgttgtcattgactttttaactaggtgttag |
242 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||| |
|
|
| T |
52708853 |
tagttgttgttattgactctttaactaggtgttag |
52708819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University